1. 호주 농업수자원부는 '19.4.1.부터 호주로 수입되는 토마토 종자 및 고추류 종자 검역에 대한 변경사항을 통보해 왔기에 다음과 같이 알려드리니 수출 시 참고하시기 바랍니다. - 다 음 - ○ PCR : 20,000립의 샘플(소량 종자의 경우 20%)을 추출하여 승인된 PCR 검사법으로 ToBRFV 무감염 증명 또는 도착지에서 검사 (비용 부과) ※ 승인된 PCR 검사법(기 허용된 프라이머에서 1세트 삭제 및 호주 개발 프라이머 추가)
Primers | Reference | 비고 | TobamodF TKGAYGGNGTBCCNGGNTGYGG TobamodR ACNGAVTBNABCTGTAATTGCTAT | Li, Y, Tan, G, Lan, P, Zhang, A, Liu, Y, Li, R, & Li, F, 2018. ‘Detection of tobamoviruses by RT-PCR using a novel pair of degenerate primers’ Journal of virological methods, volume 259, pp.122-128. | 삭제 | ToBRFV-F AATGTCCATGTTTGTTACGCC ToBRFV-R CGAATGTGATTTAAAACTGTGAAT | Alkowni, A, Alabdallah, O & Fadda, Z 2019. ‘Molecular identification of tomato brown rugose fruit virus in tomato in Palestine’ Journal of Plant Pathology, available at DOI 10.1007/s42161-019-00240-7. | 유지 | F-5476 GAAGAAGTTGTTGATGAGTTCAT R-6287 GATTTAAGTGGAGGGAAAAACAC | Levitzky, N, Smith, E, Lachman, O, Luria, N, Mizrahi, Y, Bakelman, H, Sela, N, Laskar, O, Milrot, E & Dombrovsky, A, 2019. ‘The bumblebee Bombus terrestris carries a primary inoculum of Tomato brown rugose fruit virus contributing to disease spread in tomatoes’ PloS one, volume14, issue 1, p.e0210871. | 유지 | CSP1325-F CATTTGAAAGTGCATCCGGTTT CSP1325-R GTACCACGTGTGTTTGCAGACA | ISHI-Veg 2019. Detection of Infectious Tomato brown rugose fruit virus(ToBRFV) in Tomato and Pepper Seed. https://www.worldseed.org/wp-content/ uploads/2019/05/Tomato-ToBRFV_2019_1.2.pdf | 신설 |
◎ 수출국에서 PCR검사 할 경우 위생증에 다음과 같은 부기사항 기재 : 'The consignment of [botanical name (s) (Genus species)] comprises [insert number of tomato/capsicum seed lots] seed lot(s); for each seed lot, seeds were tested by PCR [insert laboratory name(s) and report number(s)] on a sample size of 20,000 seeds (or 20 per cent of small seed lots) and found free from Tomato brown rugose fruit virus (ToBRFV).'. 끝.
|